Sequence retrieval

Genome: Bacillus amyloliquefaciens FZB42
Start position: 2609267
End position: 2609311
Length: 45

DNA sequence
>NC_009725, from 2609267 to 2609311 (45 bp); Bacillus amyloliquefaciens FZB42 ATGATGATGTGAACCATGATGATGTGAACCATGATGATGTGAACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2609121-2610341	Sequence	RBAM_024890 safA SafA (Protein is coded in complementary strand; from 2610341 to 2609121)