Sequence retrieval

Genome: Bacillus amyloliquefaciens FZB42
Start position: 921618
End position: 921647
Length: 30

DNA sequence
>NC_009725, from 921618 to 921647 (30 bp); Bacillus amyloliquefaciens FZB42 GCTGCTGCTGCTGCTGATTCTGCTGCTGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 920984-921652	Sequence	RBAM_009440 yhcQ hypothetical protein (Protein is coded in complementary strand; from 921652 to 920984)