Sequence retrieval

Genome: Bacillus amyloliquefaciens FZB42
Start position: 765743
End position: 765769
Length: 27

DNA sequence
>NC_009725, from 765743 to 765769 (27 bp); Bacillus amyloliquefaciens FZB42 ACTGGAGCTACAGGAGCTACAGGAGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 764571-766568	Sequence	RBAM_007750 - GXT repeat-containing collagen-like protein