Sequence retrieval

Genome: Bacillus amyloliquefaciens FZB42
Start position: 2776903
End position: 2776929
Length: 27

DNA sequence
>NC_009725, from 2776903 to 2776929 (27 bp); Bacillus amyloliquefaciens FZB42 GTTTCGCCTGTTTCGCATATTTCGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2776408-2777994	Sequence	RBAM_026490 ytcI hypothetical protein (Protein is coded in complementary strand; from 2777994 to 2776408)