Sequence retrieval

Genome: Bacillus amyloliquefaciens FZB42
Start position: 2263719
End position: 2263742
Length: 24

DNA sequence
>NC_009725, from 2263719 to 2263742 (24 bp); Bacillus amyloliquefaciens FZB42 TGTTTTTCTTTTTCTTTTCGTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2263662-2263889	Sequence	RBAM_021760 yqkE hypothetical protein (Protein is coded in complementary strand; from 2263889 to 2263662)