Sequence retrieval

Genome: Bacillus amyloliquefaciens FZB42
Start position: 2237745
End position: 2237768
Length: 24

DNA sequence
>NC_009725, from 2237745 to 2237768 (24 bp); Bacillus amyloliquefaciens FZB42 CAAATGCACAAATACACAAAAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2237694-2238185	Sequence	RBAM_021450 - hypothetical protein (Protein is coded in complementary strand; from 2238185 to 2237694)