Sequence retrieval

Genome: Bacillus amyloliquefaciens FZB42
Start position: 1306471
End position: 1306494
Length: 24

DNA sequence
>NC_009725, from 1306471 to 1306494 (24 bp); Bacillus amyloliquefaciens FZB42 TTCTTTATCTTTTTCCTTGTCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1305962-1306747	Sequence	RBAM_013440 motB flagellar motor protein MotB (Protein is coded in complementary strand; from 1306747 to 1305962)