Sequence retrieval

Genome: Bacillus amyloliquefaciens FZB42
Start position: 1230883
End position: 1230906
Length: 24

DNA sequence
>NC_009725, from 1230883 to 1230906 (24 bp); Bacillus amyloliquefaciens FZB42 TTATCTTTTTTTCTTTTTATCATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1230289-1230906	Sequence	RBAM_012700 ykaA hypothetical protein (Protein is coded in complementary strand; from 1230906 to 1230289)