Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 994837
End position: 994860
Length: 24

DNA sequence
>NC_009720, from 994837 to 994860 (24 bp); Xanthobacter autotrophicus Py2 CCAGCACCGGCACCAGCACCATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 993969-994931	Sequence	Xaut_0891 - inner-membrane translocator (Protein is coded in complementary strand; from 994931 to 993969)