Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 849409
End position: 849432
Length: 24

DNA sequence
>NC_009720, from 849409 to 849432 (24 bp); Xanthobacter autotrophicus Py2 GAAGATAAAGATGAAGATGAAGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 849125-849676	Sequence	Xaut_0765 - hypothetical protein (Protein is coded in complementary strand; from 849676 to 849125)