Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 739101
End position: 739124
Length: 24

DNA sequence
>NC_009720, from 739101 to 739124 (24 bp); Xanthobacter autotrophicus Py2 CGGCGGAGGCGGCGGCGAGGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 738404-739723	Sequence	Xaut_0657 - Sel1 domain-containing protein (Protein is coded in complementary strand; from 739723 to 738404)