Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 657690
End position: 657713
Length: 24

DNA sequence
>NC_009720, from 657690 to 657713 (24 bp); Xanthobacter autotrophicus Py2 TCAAGGGCAAGGACAAGGTGAAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 656820-657908	Sequence	Xaut_0587 - transposase IS116/IS110/IS902 family protein