Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 58150
End position: 58179
Length: 30

DNA sequence
>NC_009720, from 58150 to 58179 (30 bp); Xanthobacter autotrophicus Py2 GCGCCCGGCCGCGGCCGGGCGAGCCCAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 57930-58487	Sequence	Xaut_0054 - 3-hydroxydecanoyl-ACP dehydratase (Protein is coded in complementary strand; from 58487 to 57930)