Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 550409
End position: 550435
Length: 27

DNA sequence
>NC_009720, from 550409 to 550435 (27 bp); Xanthobacter autotrophicus Py2 GGCCGGTGAGGCCCGTGAGGCCGATGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 550405-550545	Sequence	Xaut_0495 - hypothetical protein (Protein is coded in complementary strand; from 550545 to 550405)