Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 5275290
End position: 5275313
Length: 24

DNA sequence
>NC_009720, from 5275290 to 5275313 (24 bp); Xanthobacter autotrophicus Py2 GCCGAGGCGGAGGCCGAGGCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5274130-5276010	Sequence	Xaut_4751 - single-stranded-DNA-specific exonuclease RecJ