Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 5121789
End position: 5121815
Length: 27

DNA sequence
>NC_009720, from 5121789 to 5121815 (27 bp); Xanthobacter autotrophicus Py2 CCTGGACCACCTGGACCACCTGGACCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5121132-5122766	Sequence	Xaut_4634 - hypothetical protein (Protein is coded in complementary strand; from 5122766 to 5121132)