Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 4903270
End position: 4903294
Length: 25

DNA sequence
>NC_009720, from 4903270 to 4903294 (25 bp); Xanthobacter autotrophicus Py2 CCCGCCCCGTCCCGCTCCGCCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4903111-4904736	Sequence	Xaut_4421 - putative beta (1-6) glucans synthase (Protein is coded in complementary strand; from 4904736 to 4903111)