Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 490040
End position: 490063
Length: 24

DNA sequence
>NC_009720, from 490040 to 490063 (24 bp); Xanthobacter autotrophicus Py2 CAGGTGCCGGTGCCGGTGCAGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 489689-490990	Sequence	Xaut_0447 - Fmu (Sun) domain-containing protein (Protein is coded in complementary strand; from 490990 to 489689)