Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 4823966
End position: 4823989
Length: 24

DNA sequence
>NC_009720, from 4823966 to 4823989 (24 bp); Xanthobacter autotrophicus Py2 TCGCCATCGTCATCGCCATCGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4823933-4827094	Sequence	Xaut_4353 - hydrophobe/amphiphile efflux-1 (HAE1) family protein