Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 466721
End position: 466744
Length: 24

DNA sequence
>NC_009720, from 466721 to 466744 (24 bp); Xanthobacter autotrophicus Py2 CAGCAGCAGCACCATCAGCATCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 466677-467558	Sequence	Xaut_0429 - inner-membrane translocator (Protein is coded in complementary strand; from 467558 to 466677)