Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 4617688
End position: 4617711
Length: 24

DNA sequence
>NC_009720, from 4617688 to 4617711 (24 bp); Xanthobacter autotrophicus Py2 CACGGCCACGGCCGCGGCGACGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4617206-4618816	Sequence	Xaut_4170 - sulfate transporter (Protein is coded in complementary strand; from 4618816 to 4617206)