Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 4531339
End position: 4531389
Length: 51

DNA sequence
>NC_009720, from 4531339 to 4531389 (51 bp); Xanthobacter autotrophicus Py2 GGGCCTTCATGACACCTTTGCCTTCATGACACCTTCGCCTTCATGGCACCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 4531107-4531349	Sequence	Xaut_4092 - phosphoribosylformylglycinamidine synthase PurS (Protein is coded in complementary strand; from 4531349 to 4531107)