Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 4510298
End position: 4510324
Length: 27

DNA sequence
>NC_009720, from 4510298 to 4510324 (27 bp); Xanthobacter autotrophicus Py2 CCGCCAGCGCCTCCAGCGCCGCCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4510261-4511232	Sequence	Xaut_4076 - alcohol dehydrogenase (Protein is coded in complementary strand; from 4511232 to 4510261)