Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 4479873
End position: 4479896
Length: 24

DNA sequence
>NC_009720, from 4479873 to 4479896 (24 bp); Xanthobacter autotrophicus Py2 GCCACCGCCGCCGCCACGTCCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4479387-4481279	Sequence	Xaut_4049 - histidine kinase (Protein is coded in complementary strand; from 4481279 to 4479387)