Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 4405518
End position: 4405562
Length: 45

DNA sequence
>NC_009720, from 4405518 to 4405562 (45 bp); Xanthobacter autotrophicus Py2 GTGGTCGTGAGCCGCGTGGTCGTGGCCGGCGTGATCGTGTCCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4403581-4405860	Sequence	Xaut_3978 - heavy metal translocating P-type ATPase (Protein is coded in complementary strand; from 4405860 to 4403581)