Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 4311019
End position: 4311063
Length: 45

DNA sequence
>NC_009720, from 4311019 to 4311063 (45 bp); Xanthobacter autotrophicus Py2 CGGCCGCTGCCGCGCCTGCGGCTGCTGCGCCCGCCGCTGCTGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4310722-4312068	Sequence	Xaut_3891 - pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase