Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 4306394
End position: 4306417
Length: 24

DNA sequence
>NC_009720, from 4306394 to 4306417 (24 bp); Xanthobacter autotrophicus Py2 CCAGGCGCAGGCGCAGGCCCAGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4306237-4306482	Sequence	Xaut_3885 - hypothetical protein (Protein is coded in complementary strand; from 4306482 to 4306237)