Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 4286785
End position: 4286820
Length: 36

DNA sequence
>NC_009720, from 4286785 to 4286820 (36 bp); Xanthobacter autotrophicus Py2 GCCTGCGGCCAAGCCCGCCGCCAAGCCCGCCGCCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4286676-4287479	Sequence	Xaut_3868 - invasion associated locus B family protein