Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 408478
End position: 408513
Length: 36

DNA sequence
>NC_009720, from 408478 to 408513 (36 bp); Xanthobacter autotrophicus Py2 CTGTCCTGAAGCGTGTCCTGAACCGTGTCCTGGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 407221-408732	Sequence	Xaut_0384 - hypothetical protein (Protein is coded in complementary strand; from 408732 to 407221)