Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 3934652
End position: 3934678
Length: 27

DNA sequence
>NC_009720, from 3934652 to 3934678 (27 bp); Xanthobacter autotrophicus Py2 CCACCACCGCCACCAGCGCCACCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3934438-3936045	Sequence	Xaut_3527 - AMP-dependent synthetase and ligase (Protein is coded in complementary strand; from 3936045 to 3934438)