Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 388440
End position: 388469
Length: 30

DNA sequence
>NC_009720, from 388440 to 388469 (30 bp); Xanthobacter autotrophicus Py2 GCTGGTGGTGGTGCAGGTGCTGATGCTGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 388340-389791	Sequence	Xaut_0374 - integral membrane sensor signal transduction histidine kinase