Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 3880140
End position: 3880163
Length: 24

DNA sequence
>NC_009720, from 3880140 to 3880163 (24 bp); Xanthobacter autotrophicus Py2 CGTCCTCGTCCTGGTCCTGGTCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3880028-3881410	Sequence	Xaut_3484 - hypothetical protein (Protein is coded in complementary strand; from 3881410 to 3880028)