Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 3856811
End position: 3856834
Length: 24

DNA sequence
>NC_009720, from 3856811 to 3856834 (24 bp); Xanthobacter autotrophicus Py2 GCCGGCGCGGGCGCCGCCTCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3856767-3857759	Sequence	Xaut_3466 - aliphatic sulfonate ABC transporter periplasmic ligand-binding protein