Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 3818738
End position: 3818761
Length: 24

DNA sequence
>NC_009720, from 3818738 to 3818761 (24 bp); Xanthobacter autotrophicus Py2 CGCTCTCGCTCTCGCTCTCGCTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3818623-3819087	Sequence	Xaut_3431 - hypothetical protein (Protein is coded in complementary strand; from 3819087 to 3818623)