Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 3807733
End position: 3807756
Length: 24

DNA sequence
>NC_009720, from 3807733 to 3807756 (24 bp); Xanthobacter autotrophicus Py2 CGATGACGACGACGAGGACGATGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3807531-3807782	Sequence	Xaut_3415 - hypothetical protein (Protein is coded in complementary strand; from 3807782 to 3807531)