Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 379625
End position: 379672
Length: 48

DNA sequence
>NC_009720, from 379625 to 379672 (48 bp); Xanthobacter autotrophicus Py2 GCTTCAGAAGAAGCCGGGCTCAGAAGAAGCCAGGCTCAGAAGAACCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 379661-381181	Sequence	Xaut_0366 - aldehyde dehydrogenase (Protein is coded in complementary strand; from 381181 to 379661)