Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 3785087
End position: 3785116
Length: 30

DNA sequence
>NC_009720, from 3785087 to 3785116 (30 bp); Xanthobacter autotrophicus Py2 TCGTCATCATCATCATCATCATCATCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3784973-3785335	Sequence	Xaut_3397 - hypothetical protein (Protein is coded in complementary strand; from 3785335 to 3784973)