Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 3781261
End position: 3781305
Length: 45

DNA sequence
>NC_009720, from 3781261 to 3781305 (45 bp); Xanthobacter autotrophicus Py2 CAAGGTCAAGCGGCTCAAGGTCAAGCAGCTCAAGGTCAAGCAGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3781306-3782253	Sequence	Xaut_3394 - ApbE family lipoprotein (Protein is coded in complementary strand; from 3782253 to 3781306)