Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 3714378
End position: 3714422
Length: 45

DNA sequence
>NC_009720, from 3714378 to 3714422 (45 bp); Xanthobacter autotrophicus Py2 GTGGTCGTGAGCCGCGTGGTCGTGGCCGGCGTGATCGTGTCCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3712441-3714720	Sequence	Xaut_3338 - heavy metal translocating P-type ATPase (Protein is coded in complementary strand; from 3714720 to 3712441)