Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 3590494
End position: 3590517
Length: 24

DNA sequence
>NC_009720, from 3590494 to 3590517 (24 bp); Xanthobacter autotrophicus Py2 GTCGAGGGCGAGGTTGAGGGCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3590477-3591082	Sequence	Xaut_3237 - potassium-transporting ATPase subunit C (Protein is coded in complementary strand; from 3591082 to 3590477)