Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 352689
End position: 352712
Length: 24

DNA sequence
>NC_009720, from 352689 to 352712 (24 bp); Xanthobacter autotrophicus Py2 GGCGGCGACGGCGGCGACGGCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 352603-353565	Sequence	Xaut_0340 - uroporphyrin-III C/tetrapyrrole methyltransferase (Protein is coded in complementary strand; from 353565 to 352603)