Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 3510665
End position: 3510700
Length: 36

DNA sequence
>NC_009720, from 3510665 to 3510700 (36 bp); Xanthobacter autotrophicus Py2 CGGCGGGCTTGGCGGCGGACTTGGCGGCCGGCTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3510451-3511143	Sequence	Xaut_3167 - alginate regulatory protein AlgP (Protein is coded in complementary strand; from 3511143 to 3510451)