Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 3396525
End position: 3396569
Length: 45

DNA sequence
>NC_009720, from 3396525 to 3396569 (45 bp); Xanthobacter autotrophicus Py2 GGCTGGGCGACGAACTGCTGGGCGGCGAGCTGCTGGCCGGCGAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3395637-3396989	Sequence	Xaut_3056 - beta-propeller repeat-containing to-pal system protein TolB (Protein is coded in complementary strand; from 3396989 to 3395637)