Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 329179
End position: 329202
Length: 24

DNA sequence
>NC_009720, from 329179 to 329202 (24 bp); Xanthobacter autotrophicus Py2 CACCACCAGCACCACCAGCAGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 327014-330253	Sequence	Xaut_0319 - hydrophobe/amphiphile efflux-1 (HAE1) family protein (Protein is coded in complementary strand; from 330253 to 327014)