Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 3245680
End position: 3245703
Length: 24

DNA sequence
>NC_009720, from 3245680 to 3245703 (24 bp); Xanthobacter autotrophicus Py2 GTGCCGGTGGCGGTGGCGGTGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3245299-3245850	Sequence	Xaut_2922 - copper/zinc binding superoxide dismutase (Protein is coded in complementary strand; from 3245850 to 3245299)