Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 3203199
End position: 3203222
Length: 24

DNA sequence
>NC_009720, from 3203199 to 3203222 (24 bp); Xanthobacter autotrophicus Py2 CGACGACGCCGATGACGACGACGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3201320-3203308	Sequence	Xaut_2876 - conjugal transfer coupling protein TraG