Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 3198768
End position: 3198791
Length: 24

DNA sequence
>NC_009720, from 3198768 to 3198791 (24 bp); Xanthobacter autotrophicus Py2 TCAAGGGCAAGGACAAGGTGAAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3197898-3198986	Sequence	Xaut_2874 - transposase IS116/IS110/IS902 family protein