Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 3153366
End position: 3153410
Length: 45

DNA sequence
>NC_009720, from 3153366 to 3153410 (45 bp); Xanthobacter autotrophicus Py2 GCTGCGGATAGCCCTGCTGCGGGTAGGCCTGCTGCGGATAAGGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3152444-3153703	Sequence	Xaut_2829 - ErfK/YbiS/YcfS/YnhG family protein (Protein is coded in complementary strand; from 3153703 to 3152444)