Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 3082470
End position: 3082493
Length: 24

DNA sequence
>NC_009720, from 3082470 to 3082493 (24 bp); Xanthobacter autotrophicus Py2 GGCGCTGGCGCTGGCGGTGGTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3081764-3083737	Sequence	Xaut_2783 - iron-hydroxamate transporter permease subunit