Sequence retrieval

Genome: Xanthobacter autotrophicus Py2
Start position: 2983637
End position: 2983660
Length: 24

DNA sequence
>NC_009720, from 2983637 to 2983660 (24 bp); Xanthobacter autotrophicus Py2 TGGGGTTGGGCTTGTGGTCGGGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2983375-2985087	Sequence	Xaut_2695 - putative succinate dehydrogenase (Protein is coded in complementary strand; from 2985087 to 2983375)